Review



lentiguide puromycin addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Addgene inc lentiguide puromycin addgene
    Lentiguide Puromycin Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 202 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiguide+puromycin+addgene/lenti+MS2-P65-HSF1_Hygro+(Plasmid+%2361426)/pm41856116-659-121-122
    Average 95 stars, based on 202 article reviews
    lentiguide puromycin addgene - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Single Cell:

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..

    Recombinant:

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..

    Software:

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..

    Chromatin Immunoprecipitation:

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..

    Magnetic Cell Separation:

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..



    Similar Products

    lentiguide puromycin addgene  (Addgene inc)
    95
    Addgene inc lentiguide puromycin addgene
    Lentiguide Puromycin Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiguide+puromycin+addgene/lenti+MS2-P65-HSF1_Hygro+(Plasmid+%2361426)/pm41856116-659-121-122
    Average 95 stars, based on 1 article reviews
    lentiguide puromycin addgene - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier

    Image Search Results